View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1772_low_21 (Length: 208)
Name: NF1772_low_21
Description: NF1772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1772_low_21 |
 | |
|
| [»] scaffold0179 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0179 (Bit Score: 72; Significance: 6e-33; HSPs: 2)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 6463 - 6570
Alignment:
| Q |
1 |
ccattcctctcctttatcctctaggataattttttgtcgtctccttttcgcttactaatctttttatagactctatcaatgaatccaccactctcaacac |
100 |
Q |
| |
|
|||| |||||||||| |||||||||||| |||||| | ||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6463 |
ccatccctctcctttctcctctaggatattttttttccttctccttttcgcttattaatctttttatagactctatgaatgaatccaccactctcaacac |
6562 |
T |
|
| Q |
101 |
cctgaaaa |
108 |
Q |
| |
|
||| |||| |
|
|
| T |
6563 |
cctcaaaa |
6570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 166 - 195
Target Start/End: Original strand, 6629 - 6658
Alignment:
| Q |
166 |
gggtgtttgattattggtgaatttgtgtct |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6629 |
gggtgtttgattattggtgaatttgtgtct |
6658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University