View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1772_low_4 (Length: 429)
Name: NF1772_low_4
Description: NF1772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1772_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 86; Significance: 6e-41; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 298 - 391
Target Start/End: Complemental strand, 6804732 - 6804639
Alignment:
| Q |
298 |
gataatttggaaaacttgacatctttcaggcttgccatacctgtttatgtcatacttaacaactttttatataattgatgagatgtggatgatg |
391 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6804732 |
gataatttggaaaacttgacatctttcaggcttgccatgcctgtttatgtcatgcttaacaactttttatataattgatgagatgtggatgatg |
6804639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 72 - 158
Target Start/End: Complemental strand, 6804965 - 6804879
Alignment:
| Q |
72 |
aaaccatcttttctatcatatacatctgatcaaattatgtaagtgtttgtgaaaatattgtatgaattaagttataacatatctctt |
158 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6804965 |
aaacaatcttttctatcatatacatctgatcaaattatgtaactgtttgtgaaaatattgtatgaattaaattataacatatctctt |
6804879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University