View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17732_low_3 (Length: 268)
Name: NF17732_low_3
Description: NF17732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17732_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 239
Target Start/End: Complemental strand, 12120403 - 12120183
Alignment:
| Q |
18 |
atattattgaacacataaattgaccccatatgcaattttcaccgtattaaaagtannnnnnnnnnatcttcaaaaattgttataaaatcaatcagattag |
117 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12120403 |
atattattgaacacataaattgacaccatatgcaattttcaccgtattaaaagtattttttttttatcttcaaaaattgttataaaatcaattagattag |
12120304 |
T |
|
| Q |
118 |
cttgggcacctaaatatcacgaggttacgcaaaaaagtaataaaatcaaaaccctgaagctatagctgctgtcaaaaacgctgccgcctgccgggattcc |
217 |
Q |
| |
|
|||||||||| || ||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
12120303 |
cttgggcacc-aagtatcacgaggttaggcaaaaaagtaataaaatcaacaccctgaagctatagctgcttccaaaaacgctgctgcctgccgggattcc |
12120205 |
T |
|
| Q |
218 |
accgtgagacattctcttttcc |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
12120204 |
accgtgagacattctcttttcc |
12120183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 236 - 268
Target Start/End: Complemental strand, 12119624 - 12119592
Alignment:
| Q |
236 |
ttcctatattgcatgccctcttagatgcaccac |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
12119624 |
ttcctatattgcatgccctcttagatgcaccac |
12119592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University