View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17734_high_15 (Length: 344)
Name: NF17734_high_15
Description: NF17734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17734_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 18 - 334
Target Start/End: Original strand, 28275095 - 28275411
Alignment:
| Q |
18 |
aaaagtgtgttctcttttctctgattttcttttacaacgggacaactgtcataacaccaaggatttgtactgcttcagcgaacaggtagaacttggcaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28275095 |
aaaagtgtgttctcttttctctgattttcttttacaacgggacaactgtcataacaccaaggatttgtactgcttcagcgaacaggtagaacttggcaat |
28275194 |
T |
 |
| Q |
118 |
gcacggctgcagttatagacatgcatgcctatgtagtccattacatctgaaataaatttaacattgtcgaactccgaaaatatttagtgcttctaatgaa |
217 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28275195 |
gcacggctgctgttatagacatgcatgcctatgtagtccattacatctgaaataaatttaacattgtcgaactccgaaaatatttagtgcttctaatgag |
28275294 |
T |
 |
| Q |
218 |
ataaagaggaaaatacactcacttcctcttatgtttggctgaatagcacaaacatcctctttacctttcaaaatgcaacaaccttcctcggttgtcacga |
317 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28275295 |
ataaagaggaaaatacactcacttcgtcttatgtttggctgaatagcacaaacatcctctttacctttcaaaatgcaacaaccttcctcggttgtcacga |
28275394 |
T |
 |
| Q |
318 |
tgttagcgatccctttg |
334 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
28275395 |
tgttagcgatccgtttg |
28275411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University