View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17734_high_20 (Length: 309)
Name: NF17734_high_20
Description: NF17734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17734_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 13 - 194
Target Start/End: Complemental strand, 42392438 - 42392260
Alignment:
| Q |
13 |
gaacaccggacaggcctttgttaaaacattatagaaattggaagtaaatggtaacgaagaaatatcacctccggaggcggcaagaaccttactgagacga |
112 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42392438 |
gaacaccggacacgcctttgttaaaacattatagaaattggaagtaaatggtaacgaa---atatcacctccggaggcggcaagaaccttactgagacga |
42392342 |
T |
 |
| Q |
113 |
gtaccggagtcgtccttaatattttcattatagaatctccttgcagctttagaatatttaggcggcgctgtgaccgcacgaa |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42392341 |
gtaccggagtcgtccttaatattttcattatagaatctccttgcagctttagaatatttaggcggcgctgtgaccgcacgaa |
42392260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 259 - 295
Target Start/End: Complemental strand, 42392195 - 42392159
Alignment:
| Q |
259 |
accggtttgagcattagccatttctttgagaaaactg |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42392195 |
accggtttgagcattagccatttctttgagaaaactg |
42392159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University