View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17734_high_21 (Length: 302)
Name: NF17734_high_21
Description: NF17734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17734_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 1 - 291
Target Start/End: Original strand, 42444714 - 42445004
Alignment:
| Q |
1 |
tacgtcgtcaaaccacacataccccagatttcttggggttgcagcaaaatatcggattttggaaggaatcaaattttggaaagggaattattattggtgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42444714 |
tacgtcgtcaaaccacacataccccagatttcttggggttgcagcaaaatatcggatcttggaaggaatcaaattttggaaagggaattattattggtgt |
42444813 |
T |
 |
| Q |
101 |
tctagattcaggaatcacacctgatgatcatccttcgtttagtgacgcaggaataccaccaccaccgtcgaaatggaaagggagatgcgaacttaatggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42444814 |
tctagattcaggaatcacacctgatgatcatccttcgtttagtgacgcaggaataccaccaccaccgtcgaaatggaaagggagatgcaaacttaatggt |
42444913 |
T |
 |
| Q |
201 |
acagtttgtaacaacaaattaattggagcaagatccttcaacaatgcagcagtaaaaggagagaaagctgaagcaccaattgatgatgatg |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42444914 |
acagtttgtaacaacaaattaattggagcaagatccttcaacaatgcagcagtaaaaggagagaaagctgaagcaccaattgatgaggatg |
42445004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University