View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17734_high_25 (Length: 274)
Name: NF17734_high_25
Description: NF17734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17734_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 21 - 119
Target Start/End: Original strand, 48060388 - 48060486
Alignment:
| Q |
21 |
tggttaccgccggaaagcgcaagttgaagacaaagaaatcatattcaaagcaaaacaatctcttcggcataatctccaaagttacactgacagcacaaa |
119 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48060388 |
tggttaccaccggaaagcgcaagttgaagacaaagaaatcatattcaaagcaaaacaatctcttcggcataatctccaaagttacactgacagcacaaa |
48060486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University