View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17734_high_28 (Length: 268)
Name: NF17734_high_28
Description: NF17734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17734_high_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 22 - 258
Target Start/End: Complemental strand, 54472324 - 54472088
Alignment:
| Q |
22 |
gaaataggagatatataaaaatatataccgtgtgctggagtagggtagtaatgaatgtgatgaggttgtgatctcttcttccttcttgtacatataacgc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54472324 |
gaaataggagatatataaaaatatataccgtgtgctggagtagggtagtaatgaatgtgatgaggttgtgatctcttcttccttcttgtacatataacgc |
54472225 |
T |
 |
| Q |
122 |
agagtaggataatgacaaggaggattatacaagctgcacctgcaactgctattataccacccacgctcaattgattcccattgttatcatttgtattgtt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54472224 |
agagtaggataatgacaaggaggattatacaagctgcacctgcaactgctattataccacccacgctcaattgattcccattgttatcatttgtattgtt |
54472125 |
T |
 |
| Q |
222 |
gccgttgttcgagggtgatgatttatgatgatgatgt |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54472124 |
gccgttgttcgagggtgatgatttatgatgatgatgt |
54472088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University