View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17734_high_30 (Length: 254)
Name: NF17734_high_30
Description: NF17734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17734_high_30 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 17 - 242
Target Start/End: Original strand, 4121471 - 4121694
Alignment:
| Q |
17 |
ggaagaggactcacttgacattgttgtatgatctcgtccttatgtatgagcaattaatgtaaaataannnnnnnnnnnngtacaaaaataannnnnnnn- |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4121471 |
ggaagaggactcacttgacattgttgtatgatctcgaccttatgtatgagcaattaatgtaaaataattatttttt---gtacaaaaataatgttttttt |
4121567 |
T |
|
| Q |
116 |
catgacaatatttatgatagaactcttactatttctcaccacacacgtctctctcatttttcattaaagtttttgacactactctttctattccttccaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
4121568 |
catgacaatatttatgatagaactcttactattactcaccacacacgtctctctcatttttcattaaagtttttgacactactctttctattccttagga |
4121667 |
T |
|
| Q |
216 |
tcattcagagctaagaaattttattca |
242 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
4121668 |
tcattcagagctaagaaattttattca |
4121694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 144 - 242
Target Start/End: Original strand, 4100785 - 4100885
Alignment:
| Q |
144 |
ctatttctcaccacacacgtctctctcatttttcattaaag--tttttgacactactctttctattccttccaatcattcagagctaagaaattttattc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | | ||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4100785 |
ctatttctcaccacacacgtctctctcatttttcatgacggaatttttgacagtactctttctattccttccaatcattgagagctaagaaattttattc |
4100884 |
T |
|
| Q |
242 |
a |
242 |
Q |
| |
|
| |
|
|
| T |
4100885 |
a |
4100885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University