View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17734_high_35 (Length: 232)
Name: NF17734_high_35
Description: NF17734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17734_high_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 10 - 217
Target Start/End: Original strand, 31933762 - 31933974
Alignment:
| Q |
10 |
gatatgaaattcgcacccaaacctgcatttagaggggatgagtttccaagtcccgccccaacccccacccgcgtcactgtcgt---aaaataatcannnn |
106 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |||| ||||| |
|
|
| T |
31933762 |
gatatcaaatttgcacccaaacctgcatttagaggggatgagtttccaagccccgccccaa-ccccacccgcgtcactgtcgtaaaaaaaaaatcaattt |
31933860 |
T |
 |
| Q |
107 |
nnnccacatcaacaaaaaatatcnnnnnnnnaagcggcaaaaatcttattatgctaagccaatgagagggacactgtgcatgca---ctttcctttcttt |
203 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| | || |||||||| |
|
|
| T |
31933861 |
tttccacatcaacaaaaaatatcttttttttaagcggcaaaaatcttattatgctaagccaatgagagggacactgtgcttgcatttcctttctttcttt |
31933960 |
T |
 |
| Q |
204 |
ctctttaggtgagt |
217 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
31933961 |
ctctttaggtgagt |
31933974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University