View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17734_low_13 (Length: 425)
Name: NF17734_low_13
Description: NF17734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17734_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 16 - 417
Target Start/End: Original strand, 23114040 - 23114436
Alignment:
| Q |
16 |
acctcaacccctaacaaacttcttaaccccccaacaagcttctttatgttttggaaaacctgtgtgtgtcactgtcacatcgtacctactagatcttatg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
23114040 |
acctcaacccctaacaaacttcttaaccccccaacaagcttctttatgttttggaaaacatgtgtgt--cactgtcacatcgtaccta---gatcttatg |
23114134 |
T |
 |
| Q |
116 |
tagcagctgcatcacaatgttggtggatctttatgttatcaaagaggttttaacgaattcgtgaaattttttagatagcataagagaaattctacaacaa |
215 |
Q |
| |
|
| ||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23114135 |
ttgcagctgcatcacaatgctggtggatctttatgttagaaaagaggttttaacgaattcgtgaaaatttttagatagcataagagaaattctacaacaa |
23114234 |
T |
 |
| Q |
216 |
atttggatagatgatctacaatggataatacttaaaaattactcaactccaatggacaaaccatattacgaatctacatcagttaggtgaccatttcaca |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23114235 |
atttggatagatgatctacaatggataatacttaaaaattactcaactccaatggacaaaccatattacgaatatacatcagttaggtgaccatttcaca |
23114334 |
T |
 |
| Q |
316 |
tatgagaagaggatggcatgtagctttcattggattttaacagtataaaggtaaatacaatttataacatatttattactatataagaaaaagatcaaga |
415 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23114335 |
tatgagaagaggatggcatgtagctttcattggattttaacagtataaaggtaaatataatttataacatatttattactatataagaaaaagatcaaga |
23114434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University