View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17734_low_16 (Length: 396)
Name: NF17734_low_16
Description: NF17734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17734_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 2e-53; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 269 - 379
Target Start/End: Complemental strand, 24850489 - 24850379
Alignment:
| Q |
269 |
gacaacgcactcaaggttagtgttgatgacgtgaacaatggagaatatgctctgaaggtgacgactgtgaaggcaaataacacaacggcggagcaggcac |
368 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24850489 |
gacaaggcactcaaggttagtgttgatgacgtgaacaatggagaatatgctctgaaggtgacgactgtgaaggcaaataacacaacggcggagcaggcac |
24850390 |
T |
|
| Q |
369 |
acactgcagct |
379 |
Q |
| |
|
||||||||||| |
|
|
| T |
24850389 |
acactgcagct |
24850379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 173 - 270
Target Start/End: Complemental strand, 24850633 - 24850536
Alignment:
| Q |
173 |
gttataaaggaaatgactctcaatatcgaaactcaaaaacacaactttcttggataagctttcttgcgaattaatttttattaatcttatccaggtga |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24850633 |
gttataaaggaaatgactctcaatatcgaaactcaaaaacacaactttcttggataagctttcttgcgaattaatttttattaatcttatccaggtga |
24850536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University