View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17734_low_22 (Length: 323)
Name: NF17734_low_22
Description: NF17734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17734_low_22 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 153 - 323
Target Start/End: Original strand, 247954 - 248125
Alignment:
| Q |
153 |
aaattggatggcaaaaagacaagttttgattgatatgtatgtacttgcgtgaacaaaacaaaacacttatatatgctattcttgttacatgatatgaatt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
247954 |
aaattggatggcaaaaagacaagttttgattgatatgtatgtacttgcatggacaaaacaaaacacttatatatgctattcttgttacatgatatgaatt |
248053 |
T |
 |
| Q |
253 |
ttttg-tacagcatatcactcacttgttgtgggtcaacttcatcattatatcattgccacactaaactactc |
323 |
Q |
| |
|
||||| |||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
248054 |
ttttgttacaacatatcactcacttgttgtaggtcaacttcatcattatatcattgccacactaaactactc |
248125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 18 - 111
Target Start/End: Original strand, 247833 - 247926
Alignment:
| Q |
18 |
ctatactaagtccaatgtttcaccctttttatgcaaatctatgtaaaagaaaaaggtatcatatataacccaaactatggtacaacatgtttac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
247833 |
ctatactaagtccaatgtttcaccctttttatgcaaatctttgtaaaagaaaaaggtatcatatataacccaaactatggtacaacatgtttac |
247926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University