View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17734_low_28 (Length: 292)
Name: NF17734_low_28
Description: NF17734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17734_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 8e-64; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 17 - 159
Target Start/End: Original strand, 6353486 - 6353629
Alignment:
| Q |
17 |
agtatacttatatttaaaccatttatcaagcagctaatccatgtgttttttatgtttgaatgaatctttttataatgcctatttgtttatcacaaaagtt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6353486 |
agtatacttatatttaaaccatttatcaagtagctaatccatgtgttttttatgtttgaatgaatctttttataatgcctatttgtttatcacaaaagtt |
6353585 |
T |
 |
| Q |
117 |
aaattttccattctaat-aaaacaattttcttcttttatttata |
159 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
6353586 |
aaatttgccattctaataaaaacaattttcttcttttgtttata |
6353629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 171 - 271
Target Start/End: Original strand, 6354011 - 6354111
Alignment:
| Q |
171 |
ggtgttggtgtgggagagggagggtggttgcttgataatatttggtgtgcggtgagggatgggtccaatactttcttttggcgggactcttggttggatt |
270 |
Q |
| |
|
||||| |||||||||||| ||||||||||| ||||||||| | ||| || ||||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
6354011 |
ggtgtaggtgtgggagagttagggtggttgcccgataatattaagcgtgtggggagggatgggtccaataatttgttttggcgggactcttggttggatt |
6354110 |
T |
 |
| Q |
271 |
t |
271 |
Q |
| |
|
| |
|
|
| T |
6354111 |
t |
6354111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University