View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17734_low_39 (Length: 250)
Name: NF17734_low_39
Description: NF17734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17734_low_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 19 - 238
Target Start/End: Original strand, 6841768 - 6841998
Alignment:
| Q |
19 |
aatccgtcggcaagactattcaaggatcgaatctaagttgaagaccaattgatcaacgatgctatttcatgaaacaaagacgcattcaccttcatcgttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6841768 |
aatccgtcggcaagactattcaaggatcgaatctaagttgaagaccaattgatcaacgatgctatttcatgaaacaaagacgcattcaccttcatcgttc |
6841867 |
T |
 |
| Q |
119 |
ggaatcctaccatt-----------tttggtctagatagaagagaaagagaatgaacactgatgaacgaagtagaagatagattcccgccaaacacaaga |
207 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6841868 |
ggaatcctacaatttttgctagtaatttggtctagatagaagagaaagagaatgaacactgatgaacgaagtagaagatagattcccgccaaacacaaga |
6841967 |
T |
 |
| Q |
208 |
attcagacattctccaactcctacgtattca |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6841968 |
attcagacattctccaactcctacgtattca |
6841998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University