View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17734_low_45 (Length: 220)
Name: NF17734_low_45
Description: NF17734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17734_low_45 |
 | |
|
| [»] scaffold0009 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0009 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 17 - 203
Target Start/End: Original strand, 103659 - 103845
Alignment:
| Q |
17 |
atcaaaatgcttataccacagttctttgtgatccagctgcatcttttcaattcaccatgctcggccgcgtgtggattttgttgttgctgtgaaatattaa |
116 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
103659 |
atcaaaatgtttataccacagttctttgtgatccagctgcatcttttcaattcaccaagctcagccgcgtgttgattttgttgttgctgtgaaatattaa |
103758 |
T |
|
| Q |
117 |
taagtgtatgttctcttctctgacgcggtgaaatcgaatgtagtgctaatgagacttgttcatctgctatagttaaagaatctgtga |
203 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
103759 |
taagtgtatgttctcttctctgtcgcggtgaaatcgaatgaagtgctaatgagacttcttcatctgctatagttaaagaatctgtga |
103845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University