View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17734_low_49 (Length: 206)
Name: NF17734_low_49
Description: NF17734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17734_low_49 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 32 - 160
Target Start/End: Original strand, 9583806 - 9583934
Alignment:
| Q |
32 |
caaagagaaaggaaactgcaatctatggatcatgagataaatgctggaggaagtgcctagtttagctaaaaaatcagcataatcatttccttctcaaaga |
131 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9583806 |
caaagagaaaggaaactacaatctatggatcatgagataaatgctggaggaagtgcctagtttagccaaaaaatcagcataatcatttccttctcaaaga |
9583905 |
T |
 |
| Q |
132 |
gcataaagaaggacaattagttgagctga |
160 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9583906 |
gcataaagaaggacaattagttgagctga |
9583934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University