View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17735_low_8 (Length: 261)
Name: NF17735_low_8
Description: NF17735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17735_low_8 |
 | |
|
| [»] scaffold0057 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 46844570 - 46844819
Alignment:
| Q |
1 |
taatttgtgtccgattagaattagaacgattccttgaaggaatgatagtgaataccatgagatcttgaacctagttgcattattgcattgcaggggtgag |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46844570 |
taatttgtgtccgattagaattagaccgattccttgaaggaatgatagtgaataccatgagatcttgaacctagttgcattattgcattgcaggggtgag |
46844669 |
T |
|
| Q |
101 |
atggcattttgcagccatgaatgccgtgaccagaggatgttgttggaggacgtgatgcctatataacacaaaagatgcctaaattggaagctaacgatga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| ||||| |
|
|
| T |
46844670 |
atggcattttgcagccatgaatgccgtgaccagaggatgttgttggaggacgtgatgcctatatagcac--aagatgcctaaattggaagctaaggatga |
46844767 |
T |
|
| Q |
201 |
ttgagtatgtgacataattccacctaaacaaaaacaatttgacctttgcttc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46844768 |
ttgagtatgtgacataattccacctaaacaaaaacaatttgacctttgcttc |
46844819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 93 - 150
Target Start/End: Complemental strand, 48986 - 48929
Alignment:
| Q |
93 |
ggggtgagatggcattttgcagccatgaatgccgtgaccagaggatgttgttggagga |
150 |
Q |
| |
|
||||||||||||||||||||| || |||||||||| ||||||||| |||||||||| |
|
|
| T |
48986 |
ggggtgagatggcattttgcaaccctgaatgccgtaaccagaggaaactgttggagga |
48929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University