View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17735_low_8 (Length: 261)

Name: NF17735_low_8
Description: NF17735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17735_low_8
NF17735_low_8
[»] chr1 (1 HSPs)
chr1 (1-252)||(46844570-46844819)
[»] scaffold0057 (1 HSPs)
scaffold0057 (93-150)||(48929-48986)


Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 46844570 - 46844819
Alignment:
1 taatttgtgtccgattagaattagaacgattccttgaaggaatgatagtgaataccatgagatcttgaacctagttgcattattgcattgcaggggtgag 100  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46844570 taatttgtgtccgattagaattagaccgattccttgaaggaatgatagtgaataccatgagatcttgaacctagttgcattattgcattgcaggggtgag 46844669  T
101 atggcattttgcagccatgaatgccgtgaccagaggatgttgttggaggacgtgatgcctatataacacaaaagatgcctaaattggaagctaacgatga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||  ||||||||||||||||||||||| |||||    
46844670 atggcattttgcagccatgaatgccgtgaccagaggatgttgttggaggacgtgatgcctatatagcac--aagatgcctaaattggaagctaaggatga 46844767  T
201 ttgagtatgtgacataattccacctaaacaaaaacaatttgacctttgcttc 252  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
46844768 ttgagtatgtgacataattccacctaaacaaaaacaatttgacctttgcttc 46844819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0057
Description:

Target: scaffold0057; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 93 - 150
Target Start/End: Complemental strand, 48986 - 48929
Alignment:
93 ggggtgagatggcattttgcagccatgaatgccgtgaccagaggatgttgttggagga 150  Q
    ||||||||||||||||||||| || |||||||||| |||||||||   ||||||||||    
48986 ggggtgagatggcattttgcaaccctgaatgccgtaaccagaggaaactgttggagga 48929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University