View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17736_low_3 (Length: 360)
Name: NF17736_low_3
Description: NF17736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17736_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 124 - 347
Target Start/End: Complemental strand, 45070921 - 45070699
Alignment:
| Q |
124 |
gctgtctagaattggaaaagcttattcatcatttaatcatacttatgtttcatatggctcttgtaattattttgaaagcattgattatcaatggatcaat |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45070921 |
gctgtctagaattggaaaagcttattcatcatttaatcatacttatgtttcatatggctcttgtaattattttgaaagcattgattatctatggatcaat |
45070822 |
T |
|
| Q |
224 |
gctctaatctagaagtgtcttactctgctactgttggactgttaatgctaagaacttgatcagaaagaacaactttcaacaaaaagtcattttcaactat |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45070821 |
gctctaatctagaagtgtcttactctgctactgttggac-cacaatgctaagaacttgatcagaaagaacaactttcaacaaaaagtcattttcaactat |
45070723 |
T |
|
| Q |
324 |
atatattgataacttgcactattt |
347 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
45070722 |
atatattgataacttgcactattt |
45070699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 19 - 56
Target Start/End: Complemental strand, 45071025 - 45070988
Alignment:
| Q |
19 |
gtaggtcctttaggctacatttgctgtttactaagacc |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45071025 |
gtaggtcctttaggctacatttgctgtttactaagacc |
45070988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University