View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17737_high_10 (Length: 456)
Name: NF17737_high_10
Description: NF17737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17737_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 2e-99; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 202 - 439
Target Start/End: Original strand, 5904132 - 5904370
Alignment:
| Q |
202 |
tatgcaaattttttattccataattcaaacccagccaattcttcttcttccaacaaaaacaaatgttacaaattcaagctcaacaaaacacgaataacca |
301 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
5904132 |
tatgcaaaatttttattccataattcaaacccagccaattcttcttcttccaacaaaaacaaatgttgcaaattcaagatcaacaaaacacgaataacca |
5904231 |
T |
 |
| Q |
302 |
caattcgtggttaatgatcacttttcttcaaatttcttagtcgaaatatacaagtttatctctttcatgcaa-nnnnnnnnnatcaaacactccaaatga |
400 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5904232 |
caatccgtggttaatgatcacttttcttcaaatttcttagtcgaaatatacaattttatctctttcatgcaattttttttttatcaaacactccaaatga |
5904331 |
T |
 |
| Q |
401 |
gtcgagttagaggacagagatcttagtagcatgttaatt |
439 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5904332 |
gtcgagttagaggacagagatcttagtagcatgttaatt |
5904370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 94 - 162
Target Start/End: Original strand, 5904034 - 5904102
Alignment:
| Q |
94 |
ttagttcaatttttgatatttatcaatgacaagtgcattgtacactcgtccacaccatttcaatttcta |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5904034 |
ttagttcaatttttgatatttatcaatgacaagtgcattgtacactcgtccacaccatttcaatttcta |
5904102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 10 - 55
Target Start/End: Original strand, 5903993 - 5904038
Alignment:
| Q |
10 |
attattctgcatttttttatttatctatgacaaatatttgtttagt |
55 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5903993 |
attattcttcatttttttatttatctatgataaatatttgtttagt |
5904038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University