View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17737_high_29 (Length: 328)
Name: NF17737_high_29
Description: NF17737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17737_high_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 13 - 316
Target Start/End: Original strand, 54098050 - 54098353
Alignment:
| Q |
13 |
agcagagaaaaggaaggcagaatatgagaaaaccatgaaggcatataacaagaaacaggtgggagaaacttctgctgcggtaagtaaatgcaaattgggt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
54098050 |
agcagagaaaaggaaggcagaatatgagaaaaccatgaaggcatataacaagaaacaggtgggtgaaacttctgctgctgtaagtaaatgcaaattgggt |
54098149 |
T |
 |
| Q |
113 |
aagtaggtttttgatgatttatttgtgattgttgtcaggctgaaggtccagctgctgttgaggaagaagaatctgggaaatcagaatctgaagtgcatga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54098150 |
aagtaggtttttgatgatttatttgtgattgttgtcaggctgaaggtccagctgctgttgaggaagaagaatctgggaaatcagaatctgaagtgcatga |
54098249 |
T |
 |
| Q |
213 |
tgagaatgaggatgatgatgaggatggcagtgaagaggtcagcacacatactttttcttttgttgaatttcactttgtaggaaagtctttgcatattgta |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
54098250 |
tgagaatgaggatgatgatgaggatggcagtgaagaggtcagcacacatactttttcttttgttgaatttcactttgtaggaaagtctttgcatatttta |
54098349 |
T |
 |
| Q |
313 |
gttg |
316 |
Q |
| |
|
|||| |
|
|
| T |
54098350 |
gttg |
54098353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University