View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17737_high_46 (Length: 242)

Name: NF17737_high_46
Description: NF17737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17737_high_46
NF17737_high_46
[»] chr5 (3 HSPs)
chr5 (21-242)||(35021021-35021245)
chr5 (165-237)||(5173794-5173866)
chr5 (165-225)||(42910466-42910526)
[»] chr7 (2 HSPs)
chr7 (168-236)||(39887633-39887701)
chr7 (171-231)||(47430757-47430817)
[»] chr3 (1 HSPs)
chr3 (176-236)||(4030229-4030289)
[»] chr4 (2 HSPs)
chr4 (163-236)||(32028221-32028294)
chr4 (176-217)||(48579375-48579416)
[»] chr8 (1 HSPs)
chr8 (176-236)||(34269311-34269371)
[»] chr1 (1 HSPs)
chr1 (167-212)||(41547338-41547383)


Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 21 - 242
Target Start/End: Complemental strand, 35021245 - 35021021
Alignment:
21 tgtctgcactcagtcactaattcttttactctctctttcacccctctacccctcttctttcaccaactaactaactaaccaataaccacagcattgaacc 120  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
35021245 tgtctgcactcagtcactaatttttttactctctctttcacccctctacccttcttctttcaccaactaactaactaaccaataaccacagcattgaacc 35021146  T
121 cgactctaattgtc---aaaactaagtgtgtgtttggtattacggcagtgatccactgtgattttgcagaagctacaaaatatatcttttgaaaaatcac 217  Q
    ||||| ||||||||   |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||    
35021145 cgactttaattgtcaaaaaaactaagtgtgtgtttggtattacggcagtgatccagtgtgattttgcagaagctacaaaatatatcttttgaaaaattac 35021046  T
218 tgtggatcaccgtgattctagctta 242  Q
     ||||||||||||||||||||||||    
35021045 ggtggatcaccgtgattctagctta 35021021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 237
Target Start/End: Original strand, 5173794 - 5173866
Alignment:
165 gtgatccactgtgattttgcagaagctacaaaatatatcttttgaaaaatcactgtggatcaccgtgattcta 237  Q
    |||||| || |||||||| ||||||||||||||| ||  |||| ||||||||| || |||||| |||||||||    
5173794 gtgatctaccgtgattttacagaagctacaaaatgtagatttttaaaaatcacggtagatcactgtgattcta 5173866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 225
Target Start/End: Original strand, 42910466 - 42910526
Alignment:
165 gtgatccactgtgattttgcagaagctacaaaatatatcttttgaaaaatcactgtggatc 225  Q
    |||||||| |||||||||| |||||||||||| |  | ||||||||||||||| |||||||    
42910466 gtgatccattgtgattttgtagaagctacaaagtgcagcttttgaaaaatcacggtggatc 42910526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 168 - 236
Target Start/End: Complemental strand, 39887701 - 39887633
Alignment:
168 atccactgtgattttgcagaagctacaaaatatatcttttgaaaaatcactgtggatcaccgtgattct 236  Q
    ||||||||||||||||||||||||||||| | || |||||| |||||||| |||| || || |||||||    
39887701 atccactgtgattttgcagaagctacaaagtgtagcttttggaaaatcacggtgggtcgccatgattct 39887633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 231
Target Start/End: Original strand, 47430757 - 47430817
Alignment:
171 cactgtgattttgcagaagctacaaaatatatcttttgaaaaatcactgtggatcaccgtg 231  Q
    |||| |||||||||||||||||| || | || ||||| |||||||| |||||||| |||||    
47430757 cactatgattttgcagaagctaccaagtgtagctttttaaaaatcattgtggatcgccgtg 47430817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 176 - 236
Target Start/End: Original strand, 4030229 - 4030289
Alignment:
176 tgattttgcagaagctacaaaatatatcttttgaaaaatcactgtggatcaccgtgattct 236  Q
    ||||||||||||||||||||| | || |||||||||||| || ||||| ||||||||||||    
4030229 tgattttgcagaagctacaaagtgtagcttttgaaaaattacagtggaccaccgtgattct 4030289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 163 - 236
Target Start/End: Complemental strand, 32028294 - 32028221
Alignment:
163 cagtgatccactgtgattttgcagaagctacaaaatatatcttttgaaaaatcactgtggatcaccgtgattct 236  Q
    ||||||| ||| ||||||||||| |||||| ||| | || ||||||||||||||  |||||||| |||||||||    
32028294 cagtgattcaccgtgattttgcataagctataaagtgtagcttttgaaaaatcatagtggatcatcgtgattct 32028221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 217
Target Start/End: Original strand, 48579375 - 48579416
Alignment:
176 tgattttgcagaagctacaaaatatatcttttgaaaaatcac 217  Q
    |||||||||||||| |||||||| |||||||| |||||||||    
48579375 tgattttgcagaagttacaaaatgtatcttttaaaaaatcac 48579416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 176 - 236
Target Start/End: Complemental strand, 34269371 - 34269311
Alignment:
176 tgattttgcagaagctacaaaatatatcttttgaaaaatcactgtggatcaccgtgattct 236  Q
    ||||| ||||||||||| |||||||| |||||||||||||||| | |||||  ||||||||    
34269371 tgattgtgcagaagctataaaatataacttttgaaaaatcactatagatcattgtgattct 34269311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 167 - 212
Target Start/End: Original strand, 41547338 - 41547383
Alignment:
167 gatccactgtgattttgcagaagctacaaaatatatcttttgaaaa 212  Q
    ||||||||||||||||| |||||||||||||| || ||||| ||||    
41547338 gatccactgtgattttgtagaagctacaaaatgtagcttttaaaaa 41547383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University