View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17737_high_47 (Length: 240)
Name: NF17737_high_47
Description: NF17737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17737_high_47 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 127 - 224
Target Start/End: Complemental strand, 15710604 - 15710508
Alignment:
| Q |
127 |
gaccatagcaacaatcttagactaagatggcgcagaacaaagcaaacacagtgtcacagcttcaagctttgaagaacaagagtgggaagtcttataat |
224 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15710604 |
gaccatatcaacaatct-agactaagatggcgcagaacaaagcaaacacagtgtcacagcttcaatctttgaagaacaagagtgggaagtcttataat |
15710508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 15 - 76
Target Start/End: Complemental strand, 15710929 - 15710868
Alignment:
| Q |
15 |
aatgtcactaaaaaatgcattattttggaaatgttaaatgaaatttcaaatatttttataga |
76 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15710929 |
aatgtcactaaaaaatgcattcttttggaaatgttaaatgaaatttcaaatatttttataga |
15710868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University