View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17737_high_56 (Length: 227)
Name: NF17737_high_56
Description: NF17737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17737_high_56 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 94 - 227
Target Start/End: Complemental strand, 15563204 - 15563071
Alignment:
| Q |
94 |
gaagccatggaagtgatcatgagcatgcatttgtatgtatgttcttttccacaagcgtgcatggtcttttggatgtagaatataacttttaaccttcact |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15563204 |
gaagccatggaagtgatcatgagcatgcatttgtatgtatgttcttttcctcaagcgtgcatggtcttttggatgtagaatataacttttaaccttcact |
15563105 |
T |
|
| Q |
194 |
tccacagaataaagcaatcagacatcaagtttcc |
227 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
15563104 |
tccacagaataaagcaatcaaacatcaagtttcc |
15563071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 15563297 - 15563258
Alignment:
| Q |
1 |
cacatgcatttcatggtgtactatccttatccaaattgac |
40 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
15563297 |
cacatgcatttaatggtgtactatccttatccaaattgac |
15563258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University