View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17737_high_68 (Length: 201)
Name: NF17737_high_68
Description: NF17737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17737_high_68 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 4e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 4e-86
Query Start/End: Original strand, 17 - 185
Target Start/End: Complemental strand, 40728985 - 40728817
Alignment:
| Q |
17 |
agaatagggttgggacggaaaagcctgaacggcgaaaaatttggagaaagaatgattcttcgagtgatagtgagagtgagagtgaagtggaatcaaagaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40728985 |
agaatagggttgggacggaaaagcctgaacggcgaaaaatttggagaaagaatgattcttcgagtgatagtgatagtgagagtgaagtggaatcaaagaa |
40728886 |
T |
 |
| Q |
117 |
tgagggatactattctaaggtgggtagtattgctgctttggggaaatatgatgtgaagagggtgaggag |
185 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40728885 |
tgaggggtactattctaaggtgggtagtattgctgctttggggaaatatgatgtgaagagggtgaggag |
40728817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 9 - 91
Target Start/End: Complemental strand, 50841976 - 50841894
Alignment:
| Q |
9 |
gagtgagaagaatagggttgggacggaaaagcctgaacggcgaaaaatttggagaaagaatgattcttcgagtgatagtgaga |
91 |
Q |
| |
|
|||||| ||||| ||||||||| | ||||||||||| || ||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
50841976 |
gagtgataagaagagggttggggcaaaaaagcctgaaaggagaaaaatttggaggaagaatgattcttctagtgatagtgaga |
50841894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University