View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17737_low_34 (Length: 323)
Name: NF17737_low_34
Description: NF17737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17737_low_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 252; Significance: 1e-140; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 5 - 307
Target Start/End: Complemental strand, 1080023 - 1079727
Alignment:
| Q |
5 |
ttgggtttcggcattccttcatcgtcattattttcacaattgggtttcgagattccttcgtcatcgcattgaccatccctgcaatccttagatggagctg |
104 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1080023 |
ttgggtttcgggattccttcatcgtcattattttcacaattgggtttcgagatcccttcgtcatcgcattgaccatccttgcaatccttagatggagctg |
1079924 |
T |
|
| Q |
105 |
tatcaacttcaacacaatgaggtaacctgttgtcatccaaaactccgttttcacttccattaagaggctttggagaattgcttttcacctgtaggttatt |
204 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1079923 |
tatcatcttcaacacaatgaagtaacctgttgtcatccaaaactccattttcacttccattaagaggctttggagaattgcttttcacctgtaggttatt |
1079824 |
T |
|
| Q |
205 |
gcttttgttaaccagtcctgatccactataacccctctttttcagcttctggatcaaatttggttggctccatgcatttgaactagaattcggagaacac |
304 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1079823 |
gctttt------aagtcctgatccactataacccctctttttcagcttctggatcaaatttggttggctccatgcatttgaactagaattcggagaacac |
1079730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 1080066 - 1080004
Alignment:
| Q |
1 |
gcagttgggtttcggcattccttcatcgtcattattttcacaattgggtttcgagattccttc |
63 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
1080066 |
gcagttgggtttcggcattccttcatcatcattcttttcacaattgggtttcgggattccttc |
1080004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 5 - 69
Target Start/End: Complemental strand, 1080101 - 1080037
Alignment:
| Q |
5 |
ttgggtttcggcattccttcatcgtcattattttcacaattgggtttcgagattccttcgtcatc |
69 |
Q |
| |
|
||||||||||| ||||||||||| ||| | ||||| || |||||||||| |||||||| ||||| |
|
|
| T |
1080101 |
ttgggtttcgggattccttcatcctcaatgttttcgcagttgggtttcggcattccttcatcatc |
1080037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University