View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17737_low_39 (Length: 287)
Name: NF17737_low_39
Description: NF17737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17737_low_39 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 257; Significance: 1e-143; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 19 - 275
Target Start/End: Complemental strand, 52287990 - 52287734
Alignment:
| Q |
19 |
attctcaaaatacctgaaaggttaaaatgacttcaaaaacactcttagcatgtgacccttcagatgatgattacattgacatggaagttagttcatactc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52287990 |
attctcaaaatacctgaaaggttaaaatgacttcaaaaacactcttagcatgtgacccttcagatgatgattacattgacatggaagttagttcatactc |
52287891 |
T |
|
| Q |
119 |
aaaattattcaatcatcattctgaaaactctcatccacaacatcctagagagtttgagttccaaatgtcttccattgttcaagagaaagaaccaacaact |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52287890 |
aaaattattcaatcatcattctgaaaactctcatccacaacatcctagagagtttgagttccaaatgtcttccattgttcaagagaaagaaccaacaact |
52287791 |
T |
|
| Q |
219 |
tcaccagctgatgagcttttctacaaaggaaaactcctcccccttcaccttccacct |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52287790 |
tcaccagctgatgagcttttctacaaaggaaaactcctcccccttcaccttccacct |
52287734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 225 - 268
Target Start/End: Original strand, 29063005 - 29063048
Alignment:
| Q |
225 |
gctgatgagcttttctacaaaggaaaactcctcccccttcacct |
268 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||| |||||||| |
|
|
| T |
29063005 |
gctgatgatctcttctacaaaggaaaactcctccctcttcacct |
29063048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University