View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17737_low_51 (Length: 242)
Name: NF17737_low_51
Description: NF17737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17737_low_51 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 235
Target Start/End: Original strand, 38079516 - 38079733
Alignment:
| Q |
18 |
atcctatgatcattttataacttacataatgtgttttatgaatttaagggagtttaaggaaactaccaaggttgataaggttgttgtactctggactgcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38079516 |
atcctatgatcattttataacttacataatgtgttttatgaatttaagggagtttaaggaaactaccaaggttgataaggttgttgtactctggactgcc |
38079615 |
T |
|
| Q |
118 |
aacactgagaggtatagtaatattgttgtgggactaaatgacaccactgaaaatcttttggcttctgtggacaagaatgaagctgagatttcaccttcaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38079616 |
aacactgagaggtatagtaatattgttgtgggactaaatgacaccactgaaaatcttttggcttctgtggacaagaatgaagctgagatttcaccttcaa |
38079715 |
T |
|
| Q |
218 |
ccctttatgcctttgctt |
235 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
38079716 |
ccctttatgccttggctt |
38079733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 64 - 235
Target Start/End: Original strand, 39699124 - 39699295
Alignment:
| Q |
64 |
agggagtttaaggaaactaccaaggttgataaggttgttgtactctggactgccaacactgagaggtatagtaatattgttgtgggactaaatgacacca |
163 |
Q |
| |
|
||||| ||||||||| | | ||| ||||| | ||||||||||||||||||||||||||| |||||||| ||||| | ||||| ||||| |||||||||| |
|
|
| T |
39699124 |
agggaatttaaggaagcaaacaaagttgacagggttgttgtactctggactgccaacacagagaggtacagtaacttagttgtaggactcaatgacacca |
39699223 |
T |
|
| Q |
164 |
ctgaaaatcttttggcttctgtggacaagaatgaagctgagatttcaccttcaaccctttatgcctttgctt |
235 |
Q |
| |
|
|| || ||||| ||| ||||||||| ||||| |||||||||||||||| ||||| | |||| |||||| |
|
|
| T |
39699224 |
tggagaacctttttgctgctgtggacagaaatgagtctgagatttcaccttccaccctgtttgccattgctt |
39699295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University