View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17737_low_54 (Length: 238)
Name: NF17737_low_54
Description: NF17737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17737_low_54 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 147 - 238
Target Start/End: Original strand, 13706398 - 13706487
Alignment:
| Q |
147 |
acacataaaattcattcttatgccttagtcataggttaaccatttgataattgttgcatgctactacctcttttacaatcttgaaggttcat |
238 |
Q |
| |
|
|||||||||| | ||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13706398 |
acacataaaagttattctta--ccttagtcaaaggttaaccatttgataattgttgcatgctactacctcttttgcaatcttgaaggttcat |
13706487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 49
Target Start/End: Original strand, 13706278 - 13706310
Alignment:
| Q |
17 |
aacaattgaattaaatcactcataatttgcggt |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
13706278 |
aacaattgaattaaatcactcataatttgcggt |
13706310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University