View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17738_high_30 (Length: 251)
Name: NF17738_high_30
Description: NF17738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17738_high_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 36223060 - 36223165
Alignment:
| Q |
1 |
tactttttacttttctacctttacaatgatttccctcattgattcaaatagtatttgcaatccaagagttgccatgacagaagcaaatacaactatcccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36223060 |
tactttttacttttctacctttacaatgatttccctcattgattcaaatagtatttgcaatccaagagttgccatgacagaagcaaatacaactatcccc |
36223159 |
T |
 |
| Q |
101 |
tgtaaa |
106 |
Q |
| |
|
|||||| |
|
|
| T |
36223160 |
tgtaaa |
36223165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 145 - 239
Target Start/End: Original strand, 36223167 - 36223261
Alignment:
| Q |
145 |
atatgtactgtgtgagaaatgaagtaacataaaaattaatattatgaaaattggcttaggtgtgttctaagagaaggaagcttttaccacaggtt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36223167 |
atatgtactgtgtgagaaatgaagtaacataaaaattaatattatgaaaattggcttaggtgtgttctaagagaaggaagcttttaccacaggtt |
36223261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University