View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17738_low_26 (Length: 295)
Name: NF17738_low_26
Description: NF17738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17738_low_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 16 - 286
Target Start/End: Original strand, 42448525 - 42448799
Alignment:
| Q |
16 |
caaaattgtattgaaaccttttattttatttctctgttgaaaaattcttatggataagctcgtttannnnnnnnnnnnnnnn----cctctaagttatgt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | |
|
|
| T |
42448525 |
caaaattgtattgaaaccttttattttatttctctgttgaaaaattcttatggataagctcgtttattttttttcttttcttttttcctctaagttatat |
42448624 |
T |
|
| Q |
112 |
tgtctgttatagctttgcctatactgccgctagaaatttacgagggaagggatacgtggggaccaacgctagaaaaatgacttccgaaacgaatctcagt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
42448625 |
tgtctgttatagctttgcctatactgccgctagaaatttacgagggaagggatacgtggggaccaacgctagaaaaatgacttccgaaacggatatcagt |
42448724 |
T |
|
| Q |
212 |
tgaaaaaacccgttgtcatcagggtttcagattactttgctcaatacaatatattttcacatttgcatttcatat |
286 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42448725 |
tgaaaaaacccgttgtcattagggtttcagattactttgctcaatacaatatattttcacatttgcatttcatat |
42448799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University