View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17738_low_30 (Length: 266)
Name: NF17738_low_30
Description: NF17738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17738_low_30 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 8 - 266
Target Start/End: Complemental strand, 36223497 - 36223239
Alignment:
| Q |
8 |
tgagatgaagcaacttgaaaggaatgagaaggtggcaatttatttatctaacatagggaacatggtgctatttgtagcaaaagtttatgcttcaattcaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36223497 |
tgagatgaagcaacttgaaaggaatgagaaggtggcaatttatttatctaacatagggaacatggtgctatttgtagcaaaagtttatgcttcaattcaa |
36223398 |
T |
|
| Q |
108 |
agtagatctttggctgtgattgcatcaactttggactcactcttggatctcttgtctggatttatactttggttcacttctcatactatgagtaaaccaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36223397 |
agtagatctttggctgtgattgcatcaactttggactcactcttggatctcttgtctggatttatactttggttcacttctcatactatgagtaaaccaa |
36223298 |
T |
|
| Q |
208 |
actatgatcaataccctattggcaagaaccgtatgcaacctgtggtaaaagcttccttc |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36223297 |
actatgatcaataccctattggcaagaaccgtatgcaacctgtggtaaaagcttccttc |
36223239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 70 - 185
Target Start/End: Complemental strand, 18645061 - 18644946
Alignment:
| Q |
70 |
tggtgctatttgtagcaaaagtttatgcttcaattcaaagtagatctttggctgtgattgcatcaactttggactcactcttggatctcttgtctggatt |
169 |
Q |
| |
|
|||||||||||| ||| || || ||||| |||||| | || ||||| || ||||||||||| || || ||||| || ||||||||||| ||||| || || |
|
|
| T |
18645061 |
tggtgctatttgcagcgaaggtatatgcatcaattgagagcagatcattagctgtgattgcttccaccttggattctctcttggatcttttgtcggggtt |
18644962 |
T |
|
| Q |
170 |
tatactttggttcact |
185 |
Q |
| |
|
||| | ||||||||| |
|
|
| T |
18644961 |
catattgtggttcact |
18644946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University