View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17738_low_38 (Length: 212)
Name: NF17738_low_38
Description: NF17738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17738_low_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 13 - 160
Target Start/End: Original strand, 701020 - 701166
Alignment:
| Q |
13 |
attcttcctaggttccaatgtagaaatacaaattgaagtgacaactttttattttataaagcttatattttgcagtggctctgcctaattaaatattgtt |
112 |
Q |
| |
|
|||||||||||||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| |||||||||| |
|
|
| T |
701020 |
attcttcctaggttcctatatagaactacaaattgaagtgacaactttttattttataaagcttatattttgtagtggctttgcctaatcaaatattgtt |
701119 |
T |
 |
| Q |
113 |
caatttttgtaaaaatgttactgatgtagcagatgttcaggatgcata |
160 |
Q |
| |
|
||| ||||||||||||||||||| ||| ||||||||||| ||| |||| |
|
|
| T |
701120 |
caa-ttttgtaaaaatgttactgctgtggcagatgttcaagatacata |
701166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University