View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17739_high_13 (Length: 203)
Name: NF17739_high_13
Description: NF17739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17739_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 1e-98; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 47386236 - 47386047
Alignment:
| Q |
1 |
aaaatataaatagttttaggaagtagtagccactgccacccaaagggcttcaccccaatttaaaaattctttgttttcattttcaccaccttctttgcac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47386236 |
aaaatataaatagttttaggaagtagtagccactgccacccaaagggattcaccccaatttaaaaattctttgttttcattttcaccaccttctttgcac |
47386137 |
T |
|
| Q |
101 |
cttcttgcccactcatacttttccattcttgcgtcactacttttcatcttctcacatgcaacaacttcttctagttccaccttctctgct |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47386136 |
cttcttgcccactcatacttttccattcttgcgtcactacttttcatcttctcacatgcaacaacttcctctagttccaccttctctgct |
47386047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 50 - 98
Target Start/End: Original strand, 47372772 - 47372820
Alignment:
| Q |
50 |
tcaccccaatttaaaaattctttgttttcattttcaccaccttctttgc |
98 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
47372772 |
tcaccccaatttaacgattcattgttttcattttcaccaccttctttgc |
47372820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 47372723 - 47372755
Alignment:
| Q |
1 |
aaaatataaatagttttaggaagtagtagccac |
33 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
47372723 |
aaaatataaatagttttaggaagtagtagccac |
47372755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University