View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17739_low_13 (Length: 215)
Name: NF17739_low_13
Description: NF17739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17739_low_13 |
 | |
|
| [»] scaffold0069 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0069 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: scaffold0069
Description:
Target: scaffold0069; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 13 - 197
Target Start/End: Complemental strand, 15533 - 15356
Alignment:
| Q |
13 |
gagaagaaaatattaatatttgaatctcgtttccgagaagctgagaagatctgcgacgacttcggtgttcgtcgttggtgttcctatctgtcggagttcg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
15533 |
gagaagaaaatattaatatttgaatctcgtttccgagaagctgagaagatctacgacgactccggtgttcgtcgttggtgttcctatctgtcggag---- |
15438 |
T |
|
| Q |
113 |
gagttcgtcgtcggagttcctgttcgccggagaaagatttatttcatggttgtgattgattttggatgagttttgatgttcttga |
197 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15437 |
---ttcgtcatcggagttcctgttcgccggagaaagatttatttcatggttgtgattgattttggatgagctttgatgttcttga |
15356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 25 - 197
Target Start/End: Original strand, 15601005 - 15601170
Alignment:
| Q |
25 |
ttaatatttgaatctcgtttccgagaagctgagaagatctgcgacgacttcggtgttcgtcgttggtgttcctatctgtcggagttcggagttcgtcgtc |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
15601005 |
ttaatatttgaatctcgtttccgagaagctgagaagatctgcgacgactccggtgttcgtcgttggtgttcctatctgtcgg-------agttcgtcgtc |
15601097 |
T |
|
| Q |
125 |
ggagttcctgttcgccggagaaagatttatttcatggttgtgattgattttggatgagttttgatgttcttga |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15601098 |
ggagttcctgttcgccggagaaagatttatttcatggttgtgattgattttggatgagttttgatgttcttga |
15601170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University