View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1773_high_115 (Length: 297)
Name: NF1773_high_115
Description: NF1773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1773_high_115 |
 |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0003 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 14 - 241
Target Start/End: Original strand, 337364 - 337591
Alignment:
| Q |
14 |
tacttttactaatagcctgttacctaatttgtagaaggacagtagtagcgttatgaatacttttcttttttggggactataaggttgataaaagtttcct |
113 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
337364 |
tacttttagtaatagcctgttacctaatttgtagaaggacagtagtagcgttatgaatacttttcttttttggggactataaggttgataaaagtttcct |
337463 |
T |
 |
| Q |
114 |
taatattcattttttcctttattagtattaaggttgaaaatagtgggacccattggaatcagttcccactttcctctcctttgccacatcgaatactccg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
337464 |
taatattcattttttcctttattagtattaaggttgaaaatagtgggacccattggaatcagttcctactttcctctcctttgccacatcgaatactccg |
337563 |
T |
 |
| Q |
214 |
tcccttctgttttgttttgccatattaa |
241 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
337564 |
tcccttctgttttgttttgccatattaa |
337591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University