View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1773_high_144 (Length: 244)
Name: NF1773_high_144
Description: NF1773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1773_high_144 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 63 - 244
Target Start/End: Complemental strand, 51407253 - 51407072
Alignment:
| Q |
63 |
ccctgttttggtgaccagtgactttatagttaggttgtagctgcaacctcaatatgctaattttatggttcttttgatttttggtgtctttgtggattat |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51407253 |
ccctgttttggtgaccagtgactttatagttaggttgtagctgcaacctcaatatgctaattttatggttcttttgatttttggtgtctttgtggattat |
51407154 |
T |
|
| Q |
163 |
tgttaatttacagcttaaccaattgctatgttattttcattttatttgttagttagaattattgcttatttacagaacagtt |
244 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51407153 |
tgttaatttacagcttaaccaattgctctgttattttcattttatttgttagttagaattattgcttatttacagaacagtt |
51407072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 219
Target Start/End: Complemental strand, 51756388 - 51756353
Alignment:
| Q |
183 |
aattgctatgttattttcattttatttgttagttaga |
219 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
51756388 |
aattgctatgttattttca-tttatttgttagttaga |
51756353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University