View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1773_high_154 (Length: 233)

Name: NF1773_high_154
Description: NF1773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1773_high_154
NF1773_high_154
[»] chr6 (5 HSPs)
chr6 (19-214)||(26504034-26504250)
chr6 (24-88)||(26453949-26454013)
chr6 (154-215)||(26453789-26453850)
chr6 (154-221)||(26521666-26521733)
chr6 (169-221)||(26521595-26521647)


Alignment Details
Target: chr6 (Bit Score: 108; Significance: 2e-54; HSPs: 5)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 19 - 214
Target Start/End: Complemental strand, 26504250 - 26504034
Alignment:
19 ggtgggggtggtgattgaggaggtggtggaggctttttcctaccttttctcacatcaggttcctccaaggctgatgg---------------------ta 97  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                     ||    
26504250 ggtgggggtggtgatcgaggaggtggtggaggctttttcctaccttttctcacatcaggttcctccaaggctgatgggaggaattgtgttggagatggta 26504151  T
98 gaaaaggctttgcaattgaagcatcctcagcagcattacatnnnnnnnttgttatcgcaaaaaagatataaataatgggatgattcaacttcattttgtt 197  Q
    |||||||||||||||||||||||||||||||||||||||||       ||||||| |||||||||||| |||||||| ||||||||| ||||||||||||    
26504150 gaaaaggctttgcaattgaagcatcctcagcagcattacataaaaaaattgttatagcaaaaaagatacaaataatgagatgattcatcttcattttgtt 26504051  T
198 ttgaaaattgaacttat 214  Q
    |||||||||||||||||    
26504050 ttgaaaattgaacttat 26504034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 24 - 88
Target Start/End: Complemental strand, 26454013 - 26453949
Alignment:
24 gggtggtgattgaggaggtggtggaggctttttcctaccttttctcacatcaggttcctccaagg 88  Q
    |||||||||||||||| || ||||||||||||||||||||||||| |||||||||||||| ||||    
26454013 gggtggtgattgaggatgtcgtggaggctttttcctaccttttcttacatcaggttcctctaagg 26453949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 154 - 215
Target Start/End: Complemental strand, 26453850 - 26453789
Alignment:
154 gcaaaaaagatataaataatgggatgattcaacttcattttgttttgaaaattgaacttatc 215  Q
    |||||||||||| |||||||| ||||||||| ||||||||| ||||||||||||||||||||    
26453850 gcaaaaaagatacaaataatgagatgattcatcttcattttattttgaaaattgaacttatc 26453789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 221
Target Start/End: Original strand, 26521666 - 26521733
Alignment:
154 gcaaaaaagatataaataatgggatgattcaacttcattttgttttgaaaattgaacttatcgatggc 221  Q
    |||||||||||| | |||||| ||||||||| |||||||||||||| ||||||||||||||| |||||    
26521666 gcaaaaaagatacatataatgagatgattcatcttcattttgttttaaaaattgaacttatcaatggc 26521733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 169 - 221
Target Start/End: Complemental strand, 26521647 - 26521595
Alignment:
169 ataatgggatgattcaacttcattttgttttgaaaattgaacttatcgatggc 221  Q
    |||||| ||||||||| |||||||||||||||||||||||||||||| |||||    
26521647 ataatgagatgattcatcttcattttgttttgaaaattgaacttatcaatggc 26521595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University