View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1773_high_154 (Length: 233)
Name: NF1773_high_154
Description: NF1773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1773_high_154 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 108; Significance: 2e-54; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 19 - 214
Target Start/End: Complemental strand, 26504250 - 26504034
Alignment:
| Q |
19 |
ggtgggggtggtgattgaggaggtggtggaggctttttcctaccttttctcacatcaggttcctccaaggctgatgg---------------------ta |
97 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
26504250 |
ggtgggggtggtgatcgaggaggtggtggaggctttttcctaccttttctcacatcaggttcctccaaggctgatgggaggaattgtgttggagatggta |
26504151 |
T |
 |
| Q |
98 |
gaaaaggctttgcaattgaagcatcctcagcagcattacatnnnnnnnttgttatcgcaaaaaagatataaataatgggatgattcaacttcattttgtt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
26504150 |
gaaaaggctttgcaattgaagcatcctcagcagcattacataaaaaaattgttatagcaaaaaagatacaaataatgagatgattcatcttcattttgtt |
26504051 |
T |
 |
| Q |
198 |
ttgaaaattgaacttat |
214 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
26504050 |
ttgaaaattgaacttat |
26504034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 24 - 88
Target Start/End: Complemental strand, 26454013 - 26453949
Alignment:
| Q |
24 |
gggtggtgattgaggaggtggtggaggctttttcctaccttttctcacatcaggttcctccaagg |
88 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
26454013 |
gggtggtgattgaggatgtcgtggaggctttttcctaccttttcttacatcaggttcctctaagg |
26453949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 154 - 215
Target Start/End: Complemental strand, 26453850 - 26453789
Alignment:
| Q |
154 |
gcaaaaaagatataaataatgggatgattcaacttcattttgttttgaaaattgaacttatc |
215 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
26453850 |
gcaaaaaagatacaaataatgagatgattcatcttcattttattttgaaaattgaacttatc |
26453789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 221
Target Start/End: Original strand, 26521666 - 26521733
Alignment:
| Q |
154 |
gcaaaaaagatataaataatgggatgattcaacttcattttgttttgaaaattgaacttatcgatggc |
221 |
Q |
| |
|
|||||||||||| | |||||| ||||||||| |||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
26521666 |
gcaaaaaagatacatataatgagatgattcatcttcattttgttttaaaaattgaacttatcaatggc |
26521733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 169 - 221
Target Start/End: Complemental strand, 26521647 - 26521595
Alignment:
| Q |
169 |
ataatgggatgattcaacttcattttgttttgaaaattgaacttatcgatggc |
221 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26521647 |
ataatgagatgattcatcttcattttgttttgaaaattgaacttatcaatggc |
26521595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University