View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1773_high_157 (Length: 230)
Name: NF1773_high_157
Description: NF1773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1773_high_157 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 19 - 230
Target Start/End: Complemental strand, 56353823 - 56353618
Alignment:
| Q |
19 |
cagacctcaaatttgcactgcctggaaaagaaagacaggattctgtttacaacggccttcaggaatgtgctgnnnnnnnnnnnnnnnnnngcttgtttaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
56353823 |
cagacctcaaatttgcactgcctggaaaagaaagacaggattctgtttacaacggccttcaggaatgtgctgtttttttttttt------gcttgtttaa |
56353730 |
T |
 |
| Q |
119 |
taatctgtatcatgaaatatttttatgtgtgctgcatttctttagcgcaattttatatcaattgaggccagagtttcttttcataccttttccttcccca |
218 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
56353729 |
taatctgtatcatgaaatatttttatgcgtgctgcatttctttagcgcaattttatatcaattgaggccagagtttcttttcataccttttccttcccaa |
56353630 |
T |
 |
| Q |
219 |
acaatgatcatt |
230 |
Q |
| |
|
|||||||||||| |
|
|
| T |
56353629 |
acaatgatcatt |
56353618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University