View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1773_high_158 (Length: 230)
Name: NF1773_high_158
Description: NF1773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1773_high_158 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 2744779 - 2745008
Alignment:
| Q |
1 |
tttatctaatggagggagaaaaatgtaccacacacaaggatttaggtaagcattttagttatggatttaacttgtgagtgaagttacagttacgcggaaa |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2744779 |
tttatccaatggagggagaaaaatgtaccacacacaaggctttaggtaagcattttagttatggatttaacttgtgagtgaagttacagttacgtggaaa |
2744878 |
T |
 |
| Q |
101 |
acctttatattgaagtaaaatacaaacgaatatggtcgatgcggctacaattgcatttgtgatgtgattgcaaagacatctaaaatcgttattgtatgtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2744879 |
acctttatattgaagtaaaatacaaacaaatatggttgatgcggctacaattgcatttgtgatgtgattgcaaagacatctaaaatcgttattgtatgtt |
2744978 |
T |
 |
| Q |
201 |
tgtgaactcgatttaaaactatatatgatt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2744979 |
tgtgaactcgatttaaaactatatatgatt |
2745008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University