View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1773_high_160 (Length: 228)
Name: NF1773_high_160
Description: NF1773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1773_high_160 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 33822556 - 33822752
Alignment:
| Q |
1 |
gtttatggaaacaattaacgataggtccataagttgatttaagtttgnnnnnnngataagctctcagttatatcttatgaaaatggctcatatcttatat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33822556 |
gtttatggaaacaattaacgataggtccataagttgatttaagtttgtttttttgataagctctcagttatatcttatgaaaatggctcatatcttatat |
33822655 |
T |
|
| Q |
101 |
gaaatgagtttgactttactttatattttgttattattagaattttagctaggtgtagaaaagctc--tgagttttg-ttttttaagtacatatagt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
33822656 |
gaaatgagtttgactttactttatattttgttattattagaattttagctaggtgtagaaaagctctttgagttttgtttttttaagtacatatagt |
33822752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 74 - 134
Target Start/End: Original strand, 33787797 - 33787857
Alignment:
| Q |
74 |
cttatgaaaatggctcatatcttatatgaaatgagtttgactttactttatattttgttat |
134 |
Q |
| |
|
|||||||||| ||| ||| |||||||||||| | ||||||||| ||||||||||||||| |
|
|
| T |
33787797 |
cttatgaaaacagcttataacttatatgaaatcaatttgactttgttttatattttgttat |
33787857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 94 - 134
Target Start/End: Complemental strand, 14666546 - 14666506
Alignment:
| Q |
94 |
cttatatgaaatgagtttgactttactttatattttgttat |
134 |
Q |
| |
|
|||||||||||| |||||||||||| ||||| ||||||||| |
|
|
| T |
14666546 |
cttatatgaaatcagtttgactttattttatcttttgttat |
14666506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 94 - 134
Target Start/End: Original strand, 28803578 - 28803618
Alignment:
| Q |
94 |
cttatatgaaatgagtttgactttactttatattttgttat |
134 |
Q |
| |
|
|||||||||||| |||||||||||| ||||| ||||||||| |
|
|
| T |
28803578 |
cttatatgaaatcagtttgactttattttatcttttgttat |
28803618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University