View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1773_high_84 (Length: 348)
Name: NF1773_high_84
Description: NF1773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1773_high_84 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 19 - 348
Target Start/End: Original strand, 18616899 - 18617228
Alignment:
| Q |
19 |
gatgagatagcaagagttgcaatttaatgatagtttttggttttgaattcaatttctaaattaaatctctttgaatgagaattttgatatgtattgtggt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18616899 |
gatgagatagcaagagttgcaatttaatgatagtttttggttttgaattcaatttctaaattaaatctctttgaatgagaattttgatatgtattgtggt |
18616998 |
T |
 |
| Q |
119 |
cctacctagttcaagtgagcagtctatatggttggctcaacttttagggtatgtttcattcgtaggggtttagtttggtgttgatgttgatttggtttcg |
218 |
Q |
| |
|
|||||||||||| |||||| ||||||||||| ||||||| ||||||||||||||||| || |||||||||||||||||||||||||||||||| | |||| |
|
|
| T |
18616999 |
cctacctagttctagtgagtagtctatatggctggctcagcttttagggtatgtttcgtttgtaggggtttagtttggtgttgatgttgatttagcttcg |
18617098 |
T |
 |
| Q |
219 |
gaggtttgnnnnnnnattggtgtttatgatgtatggtgtaagcatttcttttttagtgtttcatcccgaaatacatcgtcttttgctttgtagtttttgt |
318 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
18617099 |
gaggtttgtttttttattggtgtttatgatgtatggtgtaagcatttcttttttagtgtttcatcctgaaatacatcgtcctttgctttgtagtttttgt |
18617198 |
T |
 |
| Q |
319 |
cttacagttcgatgtttttcttgcttaggg |
348 |
Q |
| |
|
||||||| || |||||| |||| ||||||| |
|
|
| T |
18617199 |
cttacaggtccatgtttgtcttccttaggg |
18617228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University