View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1773_low_103 (Length: 322)
Name: NF1773_low_103
Description: NF1773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1773_low_103 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 11 - 306
Target Start/End: Complemental strand, 29814243 - 29813953
Alignment:
| Q |
11 |
gaagatctgaggtttgaaagaaggttatgtcggtttggtctctcacttgggtaattttgtttaactatacttgtggaagaaatcacgttgtacatgagaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29814243 |
gaagatctgaggtttgaaagaaggttatgtcggtttggtctctcacttgggtaattttgtttaactatacttgtggaagaaatcacgttgtacatgagaa |
29814144 |
T |
 |
| Q |
111 |
aaataagatttgtactcaggggagcaaaatccgcaaactgtcttgtaacataactatcgttggtgaggagatgtagatgaaacaacggataatttaatga |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
29814143 |
aaataagatttgtactcaggggagcaaaatccgcaaactgtcttgtaacataactatcgttggtggggagatgtagatgaaacaaaggataatttaatga |
29814044 |
T |
 |
| Q |
211 |
aaattttcatgttgtcgtgttatttgaaaattttatgtatacttttctctacaaataatatctaacttttgatagtaaatttttgctgatcaatat |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29814043 |
aaattttcatgttgtcgtgttatttgaaaattttatg--tacttttctctaca---aatatctaacttttgatagtaaatttttgctgatcaatat |
29813953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University