View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1773_low_117 (Length: 303)
Name: NF1773_low_117
Description: NF1773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1773_low_117 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 118 - 299
Target Start/End: Original strand, 38339125 - 38339306
Alignment:
| Q |
118 |
actccaaccacattaacaaaacataaaaataatttgttactaagatttatgtatatacttttatatatctacaaccaacacacatgactataaaacgtga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38339125 |
actccaaccacattaacaaaacataaaaataatttgttactaagatttatgtatatacttttatatatctacaaccaacacacatgactataaaacgtga |
38339224 |
T |
 |
| Q |
218 |
ttttagatgctagtaagtagtaacgacctgttaaactagttaaccaaatttaaagccgttaaaagttcttctcactcgacga |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
38339225 |
ttttagatgctagtaagtagtaacgacctgttaaactagttaaccaaatttaaagccgttaaaagttctgatcacttgacga |
38339306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University