View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1773_low_128 (Length: 277)
Name: NF1773_low_128
Description: NF1773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1773_low_128 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 6e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 60 - 231
Target Start/End: Complemental strand, 2689728 - 2689557
Alignment:
| Q |
60 |
tgacatagcattcggtggtgcaaatcctggcttcttcagcacacaaacatgtctatcccctactattagtatccgtgaaaacaacgagagagaaaccact |
159 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2689728 |
tgacatagcagcgggtggtgcaaatcctggcttcttcagcacataaacatgtctatcccctactattagtatccgtgaaaacaacgagagagaaaccact |
2689629 |
T |
 |
| Q |
160 |
taatacgaaagaagtttgctcatattcccaaggcttgtagtccttcatagctttaattaaaccgaggctata |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2689628 |
taatacgaaagaagtttgctcatattcccaaggcttgtagtccttcatagctttaattaaaccgaggctata |
2689557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 2689879 - 2689815
Alignment:
| Q |
1 |
tctgcaaattcaagttcacgaaactcccgttgcagcgctcacagttttcatcaaaatagtgacat |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2689879 |
tctgcaaattcaagttcacgaaactcccgttgcatcgctcacagttttcatcaaaatagtgacat |
2689815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 31209655 - 31209715
Alignment:
| Q |
1 |
tctgcaaattcaagttcacgaaactcccgttgcagcgctcacagttttcatcaaaatagtg |
61 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
31209655 |
tctgcaaattcaagttcaccaaactcctgttgcatcgctcacagttttcatcaaaatagtg |
31209715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University