View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1773_low_128 (Length: 277)

Name: NF1773_low_128
Description: NF1773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1773_low_128
NF1773_low_128
[»] chr3 (2 HSPs)
chr3 (60-231)||(2689557-2689728)
chr3 (1-65)||(2689815-2689879)
[»] chr7 (1 HSPs)
chr7 (1-61)||(31209655-31209715)


Alignment Details
Target: chr3 (Bit Score: 156; Significance: 6e-83; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 60 - 231
Target Start/End: Complemental strand, 2689728 - 2689557
Alignment:
60 tgacatagcattcggtggtgcaaatcctggcttcttcagcacacaaacatgtctatcccctactattagtatccgtgaaaacaacgagagagaaaccact 159  Q
    ||||||||||   |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2689728 tgacatagcagcgggtggtgcaaatcctggcttcttcagcacataaacatgtctatcccctactattagtatccgtgaaaacaacgagagagaaaccact 2689629  T
160 taatacgaaagaagtttgctcatattcccaaggcttgtagtccttcatagctttaattaaaccgaggctata 231  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2689628 taatacgaaagaagtttgctcatattcccaaggcttgtagtccttcatagctttaattaaaccgaggctata 2689557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 2689879 - 2689815
Alignment:
1 tctgcaaattcaagttcacgaaactcccgttgcagcgctcacagttttcatcaaaatagtgacat 65  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
2689879 tctgcaaattcaagttcacgaaactcccgttgcatcgctcacagttttcatcaaaatagtgacat 2689815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 31209655 - 31209715
Alignment:
1 tctgcaaattcaagttcacgaaactcccgttgcagcgctcacagttttcatcaaaatagtg 61  Q
    ||||||||||||||||||| ||||||| |||||| ||||||||||||||||||||||||||    
31209655 tctgcaaattcaagttcaccaaactcctgttgcatcgctcacagttttcatcaaaatagtg 31209715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University