View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1773_low_133 (Length: 273)
Name: NF1773_low_133
Description: NF1773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1773_low_133 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 257
Target Start/End: Complemental strand, 6790452 - 6790196
Alignment:
| Q |
1 |
gatattcttgctggcacacaattatatatgtctataatttcagttcatcatgatactcaaatatggggagaagatgctattgatttcaatccaatgagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6790452 |
gatattcttgctggcacacaattatatatgtctataatttcagttcatcatgatactcaaatatggggagaagatgctattgatttcaatccaatgagat |
6790353 |
T |
|
| Q |
101 |
ttacaaagtcccaaaagcattcatcttcatattttccatttggatttggccccaactattgtgtgggtcaaaatttagcattgattgaaatgaagattgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6790352 |
ttacaaagtcccaaaagcattcatcttcatattttccatttggatttggccccaactattgtgtgggtcaaaatttagcattgattgaaatgaagattgt |
6790253 |
T |
|
| Q |
201 |
tcttgccatgcttttgcagagatattcttttactgtttcaccaacatatgttcatgg |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6790252 |
tcttgccatgcttttgcagagatattcttttactgtttcaccaacatatgttcatgg |
6790196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University