View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1773_low_143 (Length: 251)
Name: NF1773_low_143
Description: NF1773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1773_low_143 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 14 - 251
Target Start/End: Original strand, 55395767 - 55396004
Alignment:
| Q |
14 |
ttctacctgaaactcatattttcattttctatctaaatatacaggggtctgctctggatttggaacatgaaacaattccagaagttcagaaagnnnnnnn |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55395767 |
ttctacctgaaactcatattttcattttctatctaaatatacaggggtctgctctggatttggaacatgaaacaattccagaagttcagaaagaaaaaaa |
55395866 |
T |
|
| Q |
114 |
tttaatgaaaatttgataaaattgaagggaagtgttaannnnnnnattttgatcgaaatttgcttttaggttggtgaattttatgtggatttaaatattt |
213 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55395867 |
tttaatgaaaatttgataaagttgaagggaagtgttaatttttttattttgatcgaaatttgcttttaggttggtgaattttatgtggatttaaatattt |
55395966 |
T |
|
| Q |
214 |
caatttgtaaagattttaaagagaatatgaaaatttca |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55395967 |
caatttgtaaagattttaaagagaatatgaaaatttca |
55396004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University