View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1773_low_145 (Length: 249)
Name: NF1773_low_145
Description: NF1773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1773_low_145 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 13 - 249
Target Start/End: Original strand, 56199602 - 56199851
Alignment:
| Q |
13 |
aatattactctctctcnnnnnnnctgatgaaaggaaaaggaaggttggttaatatattaataaacaaataaatcctccctcattttcattcattcaatca |
112 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
56199602 |
aatattactctctctctttttttctgatgaaaggaaaaggaaggttggttaatata---ataaacaaataaatcctccctcattttaattcattcaatca |
56199698 |
T |
 |
| Q |
113 |
aaatcaatctctatagatccaatt----------------actatattttcaattccaattcttcttcaattattactgcattgtacctggacgtataca |
196 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56199699 |
aaatcaatctctatagatccaattttaaatcctgatcattactatattttcaattccaattcttcttcaattattactgcattgtacctggacgtataca |
56199798 |
T |
 |
| Q |
197 |
tttgctttttggtgaattcttcttaattccatggtaaagtagtagtaataata |
249 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
56199799 |
tttgctttttggtgaattcttcttaattacatggtaaagtagtaataataata |
56199851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University