View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1773_low_151 (Length: 239)
Name: NF1773_low_151
Description: NF1773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1773_low_151 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 94 - 223
Target Start/End: Complemental strand, 32804125 - 32803996
Alignment:
| Q |
94 |
caccatcttcgctccctccgattcagcgttcaagaaatctggtcaaccaccactcgatcttcttctctttcacttcgtcatgttaccgctcccgcagcaa |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32804125 |
caccatcttcgctccctccgattcagcgttcaagaaatctggtcaaccatcactcgatcttcttctctttcacttcgtcatcttaccgctcccgcagcaa |
32804026 |
T |
|
| Q |
194 |
agcctccggcgtcttcccgctggcactaag |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32804025 |
agcctccggcgtcttcccgctggcactaag |
32803996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 94 - 223
Target Start/End: Complemental strand, 49028939 - 49028810
Alignment:
| Q |
94 |
caccatcttcgctccctccgattcagcgttcaagaaatctggtcaaccaccactcgatcttcttctctttcacttcgtcatgttaccgctcccgcagcaa |
193 |
Q |
| |
|
|||| |||| |||||||||||||| |||||||||||||| |||||||| ||||||||||||||| || |||||||||||||||||||| ||||||||| |
|
|
| T |
49028939 |
caccgtctttgctccctccgattccgcgttcaagaaatccggtcaaccttcactcgatcttcttcgtttccacttcgtcatgttaccgcttccgcagcaa |
49028840 |
T |
|
| Q |
194 |
agcctccggcgtcttcccgctggcactaag |
223 |
Q |
| |
|
||| | || ||||||||||| ||| ||||| |
|
|
| T |
49028839 |
agcttacgccgtcttcccgccggcgctaag |
49028810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University