View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1773_low_152 (Length: 238)
Name: NF1773_low_152
Description: NF1773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1773_low_152 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 1927114 - 1926894
Alignment:
| Q |
1 |
tccgtagagggacaagattatattttcatgttcacgtgatgattacattattcaataccaatctctttatgtggatgttgattcaatcttcaatatgaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1927114 |
tccgtagagggacaagattatattttcatgttcacgtgatgattacattattcaataccaatctctttatgtggatgtggattcaatcttcaatatgaga |
1927015 |
T |
|
| Q |
101 |
caaggttttatctcttaatttagctggagagaaaagattggttgggacccgtaaacttcaatcaattttgtgattggaatccgt-ggtgttatattataa |
199 |
Q |
| |
|
||| |||||||||||||| |||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1927014 |
caatgttttatctcttaaattagctggagagaaaagattggttgggaaccgtaaactttaatcaattttgtgattggaatccgtaggtgttatattataa |
1926915 |
T |
|
| Q |
200 |
ttttagaatcgatgccgactt |
220 |
Q |
| |
|
||||||||| ||||||||||| |
|
|
| T |
1926914 |
ttttagaattgatgccgactt |
1926894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University